6  PCR and Sanger Sequencing

6.1 Primers

6.1.1 Isopods & other peracarids

Target Primer 5’-3’ Sequence Reference
COI jgLCO1490 TGTAAAACGACGGCCAGTT5TC5AC5AAYCAYAARGAYATTGG Geller et al. (2013)
COI jgHCO2198 CAGGAAACAGCTATGACTA5ACYTC5GGRTG5CCRAARAAYCA Geller et al. (2013)
COI LCO1490-JJ CHA CWA AYC ATA AAG ATA TYG G Astrin and Stüben (2008)
COI HCO2198-JJ AWA CTT CVG GRT GVC CAA RAA TCA Astrin and Stüben (2008)
COI dgLCO1490 GGTCAACAAATCATAAAGAYATYGG Meyer (2003)
COI dgHCO2198 TAAACTTCAGGGTGACCAAARAAYCA Meyer (2003)
18S 18A1mod CTGGTTGATCCTGCCAGTCATATGC Raupach et al. (2009)
18S 400F* ACG GGT AAC GGG GAA TCA GGG Dreyer and Wägele (2001)
18S A700Fmod* GCCGCGGTAATTCCAGC Raupach et al. (2009)
18S 1000F* CGA TCA GAT ACC GCC CTA GTT C Dreyer and Wägele (2001)
18S 700R* CGC GGC TGC TGG CAC CAG CAC Dreyer and Wägele (2001)
18S 1155R* CCG TCA ATT CCT TTA AGT TTC AG Dreyer and Wägele (2001)
18S 1500Rmod* CATCTAGGGCATCACAGACC Raupach et al. (2009)
18S 1800Rmod GATCCTTCCGCAGGTTCACCTACG Raupach et al. (2009)
  • Primers marked with asterisk (*) are internal primers used for sequencing the whole 18S region.

6.2 PCR Cocktails

Using AccuStart II PCR Super Mix. Require at least 1 min at 94ºC for polymerase activation.

Components 20 μl reaction 50 μl reaction (18S)
AccuStart 10 μl 25 μl
Primer forward (10 pmol/μl) 0.5 μl 1.25 μl
Primer reverse (10 pmol/μl) 0.5 μl 1.25 μl
DNA 2-5 μl 4-6 μl
Molecular-grade water ad 20 μl ad 50 μl

6.3 PCR Programs

6.3.1 Standard 3-step

Step Process Temperature (ºC) Time To step # Cycle
1 Initial denaturation 95 5:00
2 Denaturation 95 0:45
3 Annealing 45 0:50
4 Elongation 72 1:00 2 38
5 Final elongation 72 5:00
6 Pause 10 \(\infty\)

6.3.2 3x15 Touch-up for COI

Step Process Temperature (ºC) Time To step # Cycle \(\Delta\)T
1 Initial denaturation 95 5:00
2 Denaturation 95 0:45
3 Annealing 48 1:00 + 0.5ºC
4 Elongation 72 1:00 2 15
5 Repeat touch-up loops - - 2 3
6 Final elongation 72 5:00
7 Pause 10 \(\infty\)
  • Touch-up protocol adopted from Rowther, Kardooni, and Warr (2012), has the ability to amplify low-abundant / difficult to amplify fragment while keeping primer specificit.
  • Original loop configuration was proposed as 5 loops of 10 cycles (0.5ºC step), Geller primers are able to amplify at higher temperature and 50 cycles yielded amplification in negative control, thus adjust to 3 loops of 15 cycles.
  • If primer shows less tolerance in annealing temperature, consider 4x10 configuration or other temperature gradients.

6.3.3 Touchdown for 18S (modified from Dreyer and Wägele (2001))

Step Process Temperature (ºC) Time To step # Cycle \(\Delta\)T
1 Initial denaturation 94 5:00
2 Denaturation 94 0:30
3 Annealing (1-10) 62.5 0:50 (10) - 1ºC
4 Annealing (11-36) 52.5 0:50 (26)
5 Elongation 72 2:30 2 36
6 Final elongation 72 10:00
7 Pause 10 \(\infty\)

6.4 Gel electrophoresis

  • 1% Agarose - TAE (1x) Gel
  • 0.005% MidoriGreen (2 μl for 40 ml Gel)
  • 20-25 min at 90V / 10 min at 110 V (M chamber)
  • 2-3 μl ladder / 4 μl PCR product in each gel pocket

6.5 PCR product purification

  • Take required volumn of PCR product for sequencing into new 0.5 ml stripes.
  • Mix ExoSAP mastermix fresh before purification. For every 10 μl PCR product:
    • 1 μl Exo I
    • 2 μl FAST-AP
  • Mix by gently flicking the tube, add it in the lids of the strips and spin down to products. Then no more mixing.
  • Incubate (in thermocycler): 15 min at 37ºC and 15 min at 80ºC.

6.6 Sequencing

  • Both Eurofins Lightrun and Macrogen EZ-Seq require the same composition.
  • Both Eurofins and Macrogen require booking the pick-up service in advance (one day earlier or in early morning).
  • 5 μl PCR product + 5 μl primer (5 pmol/ul)
  • Macrogen EZ-seq provides portal for metadata import: Metadata upload portal